Sequence (5' to 3'): CAUCCGGUAUCCCAAGACAAUCUCGGGUUGGGUUGGGAAGUAUCAUGGCUAAUC ACCAUGAUGCAAUCGGGUUGAACACUUAAUUGGGUUAAAACGGUGGGGGACGAU CCCGUAACAUCCGUCCUAACGGCGACAGACUGCACGGCCCUGCCUCAGGUGUGU CCAAUGAACAGUCGUUCCGAAAGGAAG

Puzzle: group I intron.

Crystal structure kindly provided by: BenoÎt Masquida

Reference: Mélanie Meyer, Henrik Nielsen, Vincent Oliéric, Pierre Roblin, Steinar D. Johansen, Eric Westhof and BenoÎt Masquida. 2014. Speciation of a group I intron into a lariat capping ribozyme. PNAS.111(21):7659-64.

PDB id: 4p9r

raw prediction | Assessment results

Comments