Sequence (5' to 3'): GGCUUAUCAAGAGAGGUGGAGGGACUGGCCCGAUGAAACCCGGCAACCACUAGU CUAGCGUCAGCUUCGGCUGACGCUAGGCUAGUGGUGCCAAUUCCUGCAGCGGAA ACGUUGAAAGAUGAGCCA

Puzzle: SAM-I riboswitch aptamer.

Crystal structure kindly provided by: Adrian Ferré-D'amaré

Reference: Baird NJ, Zhang J, Hamma T, Ferre-D'Amare AR. 2012. YbxF and YlxQ are bacterial homologs of L7Ae and bind K-turns but not K-loops. RNA 18, 759-770.

PDB id: 3v7e

raw prediction | Assessment results

Comments