Sequence (5' to 3'): CGGCAGGUGCUCCCGACCCUGCGGUCGGGAGUUAAAAGGGAAGCCGGUGCAAGU CCGGCACGGUCCCGCCACUGUGACGGGGAGUCGCCCCUCGGGAUGUGCCACUGG CCCGAAGGCCGGGAAGGCGGAGGGGCGGCGAGGAUCCGGAGUCAGGAAACCUGC CUGCCG

Puzzle: adenosylcobalamin riboswitch.

Crystal structure kindly provided by: Alexnder Serganov

Reference: Peselis A and Serganov A. 2012. Structural insights into ligand binding and gene expression control by an adenosylcobalamin riboswitch. Nature Structural and Molecular Biology 19 (11), 1182-1184.

PDB id: 4gxy

raw prediction | Assessment results

Comments