Skip to main content
logo RNA-Puzzles
  • Results
  • Open Puzzles
  • Groups
  • Publications
  • Resource
  • RSS RSS
  • RNA-Puzzles
  • Home
  • Results
  • Open Challenges
  • Community
  • Publications
  • Resouce
  • Github

Puzzle 21

Sequence (5' to 3'):

CCGGACGAGGUGCGCCGUACCCGGUCAGGACAAGACGGCGC

Puzzle: Guanidine III Riboswitch

Crystal structure kindly provided by: David M J Lilley

Reference: Structure of the Guanidine III Riboswitch. Cell Chem Biol. 2017 Nov 16;24(11):1407-1415.e2. doi: 10.1016/j.chembiol.2017.08.021. Epub 2017 Oct 5.

PDB id: 5nwq 5nz6

raw prediction | Assessment results

Posted by Chichau Miao ordinal   results

  • « Puzzle 20
  • Puzzle 22 »

RNA-Puzzles

A collective blind evaluation of RNA three-dimensional structure prediction

Recent Posts

Submission Process Research Spectrum Recent Engagements Participating Teams Methodological Progress

GitHub Repos

Status updating...

@RNA-Puzzles on GitHub

Categories

group (4)
news (7)
results (39)
table (66)

Google+

Copyright © 2023 - Chichau Miao; The website is powered by cloudna.