Sequence (5' to 3'): ACCCGCAAGGCCGACGGC-GCCGCCGCUGGUGCAAGUCCAGCCACGCUUCGGCGUGGGCGCUCAUGGGU

Puzzle: Another Twister Sister robozyme

Crystal structure kindly provided by: Amy Ren

Reference: Zheng, L., Mairhofer, E., Teplova, M., Zhang, Y., Ma, J., Patel, D.J., Micura, R., Ren, A. Structure-based insights into self-cleavage by a four-way junctional twister-sister ribozyme. (2017) Nat Commun 8: 1180-1180

PDB id: 5y85 5y87

raw prediction | Assessment results

Comments