Sequence (5' to 3'):

UUACUGUGAGAAUCAGUAACAAACAUGUGGGGCUUAUAU CUAAUCGAAAGAUUAGUAUUAGUGCAGAC

GUUAAAACCAUGUC

Puzzle: Hatchet Ribozyme

Crystal structure kindly provided by: Aiming Ren

Reference: Hatchet ribozyme structure and implications for cleavage mechanism. Proc Natl Acad Sci U S A. 2019 May 28;116(22):10783-10791. doi: 10.1073/pnas.1902413116. Epub 2019 May 14.

PDB id: 6jq5 6jq6

raw prediction | Assessment results monomer dimer

Comments