Sequence (5' to 3'):
T-box:
UGCGAUGAGAAGAAGAGUAUUAAGGAUUUACUAUGAUUAGCGACUCUAGGAUAG UGAAAGCUAGAGGAUAGUAACCUUAAGAAGGCACUUCGAGCA tRNA:
GCGGAAGUAGUUCAGUGGUAGAACACCACCUUGCCAAGGUGGGGGUCGCGGGUU CGAAUCCCGUCUUCCGCUCCA

Puzzle: T-box riboswitch - tRNA complex.

Crystal structure kindly provided by: Adrian Ferré-D'amaré

Reference: Zhang, J. & Ferré-D'Amaré, A.R. Co-crystal structure of a T-box riboswitch stem I domain in complex with its cognate tRNA. Nature 500, 363-366 (2013).

PDB id: 4lck

raw prediction | Assessment results

Comments