Sequence (5' to 3'): GGGUCAGGCCGGCGAAAGUCGCCACAGUUUGGGGAAAGCUGUGCAGCCUGUAAC CCCCCCACGAAAGUGGG

Puzzle: Zika virus.

Crystal structure kindly provided by: Jeffrey S. Kieft

Reference: Zika virus produces noncoding RNAs using a multi-pseudoknot structure that confounds a cellular exonuclease. (2016) Science 354: 1148-1152. DOI: 10.1126/science.aah3963.

PDB id: 5tpy

raw prediction | Assessment results

Comments