Puzzle 24

Puzzle 24

Sequence (5' to 3'):

GGACCUCGCAAGGGUAUCAUGGCGGACGACCGGGGUUCGAACCCCGGAUCCGGCCGUCCGCCGUGAUCCAUGCGGUUACCGCCCGCGUGUCGAACCCAGGUGUGCGAGGUCC

Puzzle: adenovirus virus-associated RNA

Crystal structure kindly provided by: Jingwei Zhang

Reference: Crystal structure of an adenovirus virus-associated RNA. Nature Communicationsvolume 10, Article number: 2871 (2019).

PDB id: 6ol3

raw prediction | Assessment results

Puzzle 21

Puzzle 21

Sequence (5' to 3'):

CCGGACGAGGUGCGCCGUACCCGGUCAGGACAAGACGGCGC

Puzzle: Guanidine III Riboswitch

Crystal structure kindly provided by: David M J Lilley

Reference: Structure of the Guanidine III Riboswitch. Cell Chem Biol. 2017 Nov 16;24(11):1407-1415.e2. doi: 10.1016/j.chembiol.2017.08.021. Epub 2017 Oct 5.

PDB id: 5nwq 5nz6

raw prediction | Assessment results

Puzzle 20

Puzzle 20

Sequence (5' to 3'): ACCCGCAAGGCCGACGGC-GCCGCCGCUGGUGCAAGUCCAGCCACGCUUCGGCGUGGGCGCUCAUGGGU

Puzzle: Another Twister Sister robozyme

Crystal structure kindly provided by: Amy Ren

Reference: Zheng, L., Mairhofer, E., Teplova, M., Zhang, Y., Ma, J., Patel, D.J., Micura, R., Ren, A. Structure-based insights into self-cleavage by a four-way junctional twister-sister ribozyme. (2017) Nat Commun 8: 1180-1180

PDB id: 5y85 5y87

raw prediction | Assessment results

Puzzle 19

Puzzle 19

Sequence (5' to 3'):

GCAGGGCAAGGCCCAGUCCCGUGCAAGCCGGGACCGCCCC- GGGGCGCGGCGCUCAUUCCUGC

Puzzle: One Twister Sister robozyme

Crystal structure kindly provided by: David M J Lilley

Reference: The structure of a nucleolytic ribozyme that employs a catalytic metal ion. Nature Chemical Biology 13, 508–513 (2017) doi:10.1038/nchembio.2333.

PDB id: 5t5a

raw prediction | Assessment results

Puzzle 18

Puzzle 18

Sequence (5' to 3'): GGGUCAGGCCGGCGAAAGUCGCCACAGUUUGGGGAAAGCUGUGCAGCCUGUAAC CCCCCCACGAAAGUGGG

Puzzle: Zika virus.

Crystal structure kindly provided by: Jeffrey S. Kieft

Reference: Zika virus produces noncoding RNAs using a multi-pseudoknot structure that confounds a cellular exonuclease. (2016) Science 354: 1148-1152. DOI: 10.1126/science.aah3963.

PDB id: 5tpy

raw prediction | Assessment results

Puzzle 17

Puzzle 17

Sequence (5' to 3'): CGUGGUUAGGGCCACGUUAAAUAGUUGCUUAAGCCCUAAGCGUUGAUAAAUAUC AGGUGCAA

Puzzle: Pistol ribozyme.

Crystal structure kindly provided by: Dinshaw Patel

Reference: Pistol ribozyme adopts a pseudoknot fold facilitating site-specific in-line cleavage. Nature Chemical Biology 12, 702–708 (2016) doi:10.1038/nchembio.2125.

PDB id: 5k7c

raw prediction | Assessment results

Puzzle 16

Puzzle 16

Sequence (5' to 3'): TBA

Puzzle: TBA.

Crystal structure kindly provided by: TBA

Reference: TBA

PDB id: TBA

raw prediction | Assessment results

Puzzle 15

Puzzle 15

Sequence (5' to 3'): GGGUACUUAAGCCCACUGAUGAGUCGCUGGGAUGCGACGAAACGCCCA- GGGCGUCUGGGCAGUACCCA

Puzzle: Hammerhead Ribozyme. Predict as 2 chains.

Crystal structure kindly provided by: Barbara L. Golden

Reference: Two Active Site Divalent Ions in the Crystal Structure of the Hammerhead Ribozyme Bound to a Transition State Analogue. Biochemistry, 2016, 55 (4), pp 633–636 DOI: 10.1021/acs.biochem.5b01139.

PDB id: 5di4

raw prediction | Assessment results

Puzzle 14

Puzzle 14

Sequence (5' to 3'):
Bound form:
CGUUGACCCAGGAAACUGGGCGGAAGUAAGGCCCAUUGCACUCCGGGCCUGAAG CAACGCG
Free form:
CGUUGGCCCAGGAAACUGGGUGGAAGUAAGGCCCAUUGCACUCCGGGCCUGAAG CAACGCU

Puzzle: L-glutamine riboswitch. Predict both Free and Bound forms.

Crystal structure kindly provided by: Dinshaw Patel

Reference: Aiming Ren, Yi Xue, Alla Peselis, Alexander Serganov, Hashim M. Al-Hashimi, Dinshaw J. Patel. Structural and Dynamic Basis for Low-Affinity, High- Selectivity Binding of L-Glutamine by the Glutamine Riboswitch. Cell Rep. 2015 Dec 1;13(9):1800-13.01251-6)

PDB id: 5ddo

Bound Form: raw prediction | Assessment results

Free Form: raw prediction | Assessment results

Puzzle 13

Puzzle 13

Sequence (5' to 3'): GGGUCGUGACUGGCGAACAGGUGGGAAACCACCGGGGAGCGACCCCGGCAUCGA UAGCCGCCCGCCUGGGC

Puzzle: ZMP Riboswitch.

Crystal structure kindly provided by: Robert T. Batey

Reference: Trausch JJ, Marcano-Velázquez JG, Matyjasik MM, Batey RT. Metal Ion-Mediated Nucleobase Recognition by the ZTP Riboswitch. Chem Biol. 2015 Jul 23;22(7):829-37.

PDB id: 4xw7

raw prediction | Assessment results

Puzzle 12

Puzzle 12

Sequence (5' to 3'): AUCGCUGAACGCGGGGGACCCAGGGGGCGAAUCUCUUCCGAAAGGAAGAGUAGG GUUACUCCUUCGACCCGAGCCCGUCAGCUAACCUCGCAAGCGUCCGAAGGAGAA AAA

Puzzle: ydaO riboswitch.

Crystal structure kindly provided by: Dinshaw Patel

Reference: Ren A, Patel DJ. 2014. c-di-AMP binds the ydaO riboswitch in two pseudo-symmetry-related pockets. Nat Chem Biol. 10(9):780-6.

PDB id: 4qlm

raw prediction | Assessment results

Puzzle 11

Puzzle 11

Sequence (5' to 3'): GGGAUCUGUCACCCCAUUGAUCGCCUUCGGGCUGAUCUGGCUGG
CUAGGCGGGUCCC

Puzzle: 7SK

Crystal structure kindly provided by: Anne-Catherine Dock-Bregeon

Reference: Martinez-Zapien D, Legrand P, McEwen AG, Proux F, Cragnolini T, Pasquali S, Dock-Bregeon AC. The crystal structure of the 5΄ functional domain of the transcription riboregulator 7SK. Nucleic Acids Res. 2017 Apr 7;45(6):3568-3579. doi: 10.1093/nar/gkw1351. Bourbigot S, Dock-Bregeon AC, Eberling P, Coutant J, Kieffer B, Lebars I. Solution structure of the 5'-terminal hairpin of the 7SK small nuclear RNA. RNA. 2016 Dec;22(12):1844-1858. Epub 2016 Oct 20.

PDB id: 5lys 5lyu 5lyv 5iem

raw prediction | Assessment results

Puzzle 10

Puzzle 10

Sequence (5' to 3'):
T-box:
UGCGAUGAGAAGAAGAGUAUUAAGGAUUUACUAUGAUUAGCGACUCUAGGAUAG UGAAAGCUAGAGGAUAGUAACCUUAAGAAGGCACUUCGAGCA

tRNA:
GCGGAAGUAGUUCAGUGGUAGAACACCACCUUGCCAAGGUGGGGGUCGCGGGUU CGAAUCCCGUCUUCCGCUCCA

Puzzle: T-box riboswitch - tRNA complex.

Crystal structure kindly provided by: Adrian Ferré-D'amaré

Reference: Zhang, J. & Ferré-D'Amaré, A.R. Co-crystal structure of a T-box riboswitch stem I domain in complex with its cognate tRNA. Nature 500, 363-366 (2013).

PDB id: 4lck

Assessment of complex: raw prediction | Assessment results

Assessment of tBox: raw prediction | Assessment results

Assessment of tBox: raw prediction | Assessment results

Puzzle 9

Puzzle 9

Sequence (5' to 3'): GGACACUGAUGAUCGCGUGGAUAUGGCACGCAUUGAAUUGU
UGGACACCGUAAAUGUCCUAACACGUGUCC

Puzzle: 5-hydroxytryptophan aptamer

Crystal structure kindly provided by: Robert T. Batey

Reference: Ely B Porter, Jacob T Polaski, Makenna M Morck & Robert T Batey. Recurrent RNA motifs as scaffolds for genetically encodable small-molecule biosensors. Nature Chemical Biology volume 13, pages 295–301 (2017)

PDB id: 5kpy

raw prediction | Assessment results

Puzzle 8

Puzzle 8

Sequence (5' to 3'): GGAUCACGAGGGGGAGACCCCGGCAACCUGGGACGGACACCCAAGGUGCUCACA CCGGAGACGGUGGAUCCGGCCCGAGAGGGCAACGAAGUCCGU

Puzzle: SAM riboswitch.

Crystal structure kindly provided by: Robert T. Batey

Reference: Trausch JJ, Xu Z, Edwards AL, Reyes FE, Ross PE, Knight R, Batey RT. 2014. Structural basis for diversity in the SAM clan of riboswitches. PNAS.111(18):6624-9.

PDB id: 4l81

raw prediction | Assessment results

Puzzle 7

Puzzle 7

Sequence (5' to 3'): GCGCUGUGUCGCAAUCUGCGAAGGGCGUCGUCGGCCCGAGCGGUAGUAAGCAGG GAACUCACCUCCAAUGAAACACAUUGUCGUAGCAGUUGACUACUGUUAUGUGAU UGGUAGAGGCUAAGUGACGGUAUUGGCGUAAGCCAAUACCGCGGCACAGCACAA GCCCGCUUGCGAGAUUACAGCGC

Puzzle: Varkud satellite ribozyme.

Crystal structure kindly provided by: Joseph A Piccirilli

Reference: Nikolai B Suslov, Saurja DasGupta, Hao Huang, James R Fuller, David M J Lilley, Phoebe A Rice& Joseph A Piccirilli. 2015. Crystal structure of the Varkud satellite ribozyme. Nature Chemical Biology 11, 840–846.

PDB id: 4r4v

raw prediction | Assessment results

Puzzle 6

Puzzle 6

Sequence (5' to 3'): CGGCAGGUGCUCCCGACCCUGCGGUCGGGAGUUAAAAGGGAAGCCGGUGCAAGU CCGGCACGGUCCCGCCACUGUGACGGGGAGUCGCCCCUCGGGAUGUGCCACUGG CCCGAAGGCCGGGAAGGCGGAGGGGCGGCGAGGAUCCGGAGUCAGGAAACCUGC CUGCCG

Puzzle: adenosylcobalamin riboswitch.

Crystal structure kindly provided by: Alexnder Serganov

Reference: Peselis A and Serganov A. 2012. Structural insights into ligand binding and gene expression control by an adenosylcobalamin riboswitch. Nature Structural and Molecular Biology 19 (11), 1182-1184.

PDB id: 4gxy

raw prediction | Assessment results

Puzzle 5

Puzzle 5

Sequence (5' to 3'): CAUCCGGUAUCCCAAGACAAUCUCGGGUUGGGUUGGGAAGUAUCAUGGCUAAUC ACCAUGAUGCAAUCGGGUUGAACACUUAAUUGGGUUAAAACGGUGGGGGACGAU CCCGUAACAUCCGUCCUAACGGCGACAGACUGCACGGCCCUGCCUCAGGUGUGU CCAAUGAACAGUCGUUCCGAAAGGAAG

Puzzle: group I intron.

Crystal structure kindly provided by: BenoÎt Masquida

Reference: Mélanie Meyer, Henrik Nielsen, Vincent Oliéric, Pierre Roblin, Steinar D. Johansen, Eric Westhof and BenoÎt Masquida. 2014. Speciation of a group I intron into a lariat capping ribozyme. PNAS.111(21):7659-64.

PDB id: 4p9r

raw prediction | Assessment results

Puzzle 4

Puzzle 4

Sequence (5' to 3'): GGCUUAUCAAGAGAGGUGGAGGGACUGGCCCGAUGAAACCCGGCAACCACUAGU CUAGCGUCAGCUUCGGCUGACGCUAGGCUAGUGGUGCCAAUUCCUGCAGCGGAA ACGUUGAAAGAUGAGCCA

Puzzle: SAM-I riboswitch aptamer.

Crystal structure kindly provided by: Adrian Ferré-D'amaré

Reference: Baird NJ, Zhang J, Hamma T, Ferre-D'Amare AR. 2012. YbxF and YlxQ are bacterial homologs of L7Ae and bind K-turns but not K-loops. RNA 18, 759-770.

PDB id: 3v7e

raw prediction | Assessment results

Puzzle 3

Puzzle 3

Sequence (5' to 3'): CUCUGGAGAGAACCGUUUAAUCGGUCGCCGAAGGAGCAAGCUCUGCGCAUAUGC AGAGUGAAACUCUCAGGCAAAAGGACAGAG

Puzzle: The crystallized sequence was slightly different (an apical loop was replaced by a GAAA loop) but it was not mentioned to protect the crystallographers.

Crystal structure kindly provided by: Dinshaw Patel

Reference: Huang L, Serganov A, Patel DJ. 2010. Structural Insights into Ligand Recognition by a Sensing Domain of the Cooperative Glycine Riboswitch. Mol. Cell. 40, 774-786.

PDB id: 3owz

raw prediction | Assessment results

Puzzle 2

Puzzle 2

Sequence (5' to 3'):

Puzzle: The crystal structure shows a 100 nt square that assembles from four inner and four outer strands. The secondary structure shown was used for the design of the square. Actual base pairing in the crystal may deviate. 3D coordinates of the nucleotides in the inner strands (B,D,F,H) were provided. What are the structures of the outer strands (A,C,E,G)?

Crystal structure kindly provided by: Thomas Hermann

Reference: Dibrov SM, McLean J, Parsons J, Hermann T. 2011. Self-assembling RNA square. PNAS 108, 6405-6408.

PDB id: 3p59

raw prediction | Assessment results

Puzzle 1

Puzzle 1

Sequence (5' to 3'): CCGCCGCGCCAUGCCUGUGGCGG

Puzzle: knowing that the crystal structure shows a homodimer that contains two strands of the sequence. The strands hybridize with blunt ends (C-G closing base pairs).

Crystal structure kindly provided by: Thomas Hermann

Reference: Dibrov SM, McLean J, Hermann T. 2011. Structure of an RNA dimer of a regulatory element from human thymidylate synthase mRNA, Acta Cryst. D, Biological Crystallography 67, 97-104.

PDB id: 3mei

raw prediction | Assessment results

Comments