Sequence (5' to 3'): GGACACUGAUGAUCGCGUGGAUAUGGCACGCAUUGAAUUGU
UGGACACCGUAAAUGUCCUAACACGUGUCC

Puzzle: 5-hydroxytryptophan aptamer

Crystal structure kindly provided by: Robert T. Batey

Reference: Ely B Porter, Jacob T Polaski, Makenna M Morck & Robert T Batey. Recurrent RNA motifs as scaffolds for genetically encodable small-molecule biosensors. Nature Chemical Biology volume 13, pages 295–301 (2017)

PDB id: 5kpy

raw prediction | Assessment results

Comments