Sequence (5' to 3'): GGAUCACGAGGGGGAGACCCCGGCAACCUGGGACGGACACCCAAGGUGCUCACA CCGGAGACGGUGGAUCCGGCCCGAGAGGGCAACGAAGUCCGU

Puzzle: SAM riboswitch.

Crystal structure kindly provided by: Robert T. Batey

Reference: Trausch JJ, Xu Z, Edwards AL, Reyes FE, Ross PE, Knight R, Batey RT. 2014. Structural basis for diversity in the SAM clan of riboswitches. PNAS.111(18):6624-9.

PDB id: 4l81

raw prediction | Assessment results

Comments