Sequence (5' to 3'): GCGCUGUGUCGCAAUCUGCGAAGGGCGUCGUCGGCCCGAGCGGUAGUAAGCAGG GAACUCACCUCCAAUGAAACACAUUGUCGUAGCAGUUGACUACUGUUAUGUGAU UGGUAGAGGCUAAGUGACGGUAUUGGCGUAAGCCAAUACCGCGGCACAGCACAA GCCCGCUUGCGAGAUUACAGCGC

Puzzle: Varkud satellite ribozyme.

Crystal structure kindly provided by: Joseph A Piccirilli

Reference: Nikolai B Suslov, Saurja DasGupta, Hao Huang, James R Fuller, David M J Lilley, Phoebe A Rice& Joseph A Piccirilli. 2015. Crystal structure of the Varkud satellite ribozyme. Nature Chemical Biology 11, 840–846.

PDB id: 4r4v

raw prediction | Assessment results

Comments