Sequence (5' to 3'): CUCUGGAGAGAACCGUUUAAUCGGUCGCCGAAGGAGCAAGCUCUGCGCAUAUGC AGAGUGAAACUCUCAGGCAAAAGGACAGAG

Puzzle: The crystallized sequence was slightly different (an apical loop was replaced by a GAAA loop) but it was not mentioned to protect the crystallographers.

Crystal structure kindly provided by: Dinshaw Patel

Reference: Huang L, Serganov A, Patel DJ. 2010. Structural Insights into Ligand Recognition by a Sensing Domain of the Cooperative Glycine Riboswitch. Mol. Cell. 40, 774-786.

PDB id: 3owz

raw prediction | Assessment results

Comments