Sequence (5' to 3'):

tRNA:
GGGCCUAUAGCUCAGGCGGUUAGAGCGCUUCGCUGAUAACGA
AGAGGUCGGAGGUUCGAGUCCUCCUAGGCCCACCA

T-box:
GGCGACGAUCCGGCCAUCACCGGGGAGCCUUCGGAAGAACGG
CGCCGCCGGAAACGGCGGCGCUCAGUAGAACCGAACGGGUGA
GCCCGUCACAGCUC

Puzzle: T-box riboswitch - tRNA complex (Nocardia farcinica ileS)

Crystal structure kindly provided by: Jingwei Zhang

Reference: High-affinity recognition of specific tRNAs by an mRNA anticodon-binding groove. Nat Struct Mol Biol. 2019 Dec;26(12):1114-1122. doi: 10.1038/s41594-019-0335-6. Epub 2019 Dec 2.

PDB id: 6ufm

raw prediction | Assessment results Complex T-box

Comments