Sequence (5' to 3'):

tRNA: GCGGAAGTAGTTCAGTGGTAGAACACCACCTTGCCAAGGTGGG
GGTCGCGGGTTCGAATCCCGTCTTCCGCTCCA

T-box: GUUGCAGUGAGAGAAAGAAGUACUUGCGUUUACCUCAUGAAAG
CGACCUUAGGGCGGUGUAAGCUAAGGAUGAGCACGCAACGAAA
GGCAUUCUUGAGCAAUUUUAAAAAAGAGGCUGGGAUUUUGUUC
UCAGCAACUAGGGUGGAACCGCGGGAGAACUCUCGUCCCUA

Puzzle: T-box riboswitch - tRNA complex (Bacillus subtilis glyQS)

Crystal structure kindly provided by: Jingwei Zhang

Reference: Structural basis of amino acid surveillance by higher-order tRNA-mRNA interactions. Nat Struct Mol Biol. 2019 Dec;26(12):1094-1105. doi: 10.1038/s41594-019-0326-7. Epub 2019 Nov 18.

PDB id: 6pom

raw prediction | Assessment results Complex T-box

Comments