Sequence (5' to 3'):

GGACCUCGCAAGGGUAUCAUGGCGGACGACCGGGGUUCGAACCCCGGAUC
CGGCCGUCCGCCGUGAUCCAUGCGGUUACCGCCCGCGUGUCGAACCCAGG
UGUGCGAGGUCC

Puzzle: adenovirus virus-associated RNA

Crystal structure kindly provided by: Jingwei Zhang

Reference: Crystal structure of an adenovirus virus-associated RNA. Nature Communicationsvolume 10, Article number: 2871 (2019).

PDB id: 6ol3

raw prediction | Assessment results

Comments