Sequence (5' to 3'): GGGUACUUAAGCCCACUGAUGAGUCGCUGGGAUGCGACGAAACGCCCA- GGGCGUCUGGGCAGUACCCA

Puzzle: Hammerhead Ribozyme. Predict as 2 chains.

Crystal structure kindly provided by: Barbara L. Golden

Reference: Two Active Site Divalent Ions in the Crystal Structure of the Hammerhead Ribozyme Bound to a Transition State Analogue. Biochemistry, 2016, 55 (4), pp 633–636 DOI: 10.1021/acs.biochem.5b01139.

PDB id: 5di4

raw prediction | Assessment results

Comments