Sequence (5' to 3'):
Bound form:
CGUUGACCCAGGAAACUGGGCGGAAGUAAGGCCCAUUGCACUCCGGGCCUGAAG CAACGCG
Free form:
CGUUGGCCCAGGAAACUGGGUGGAAGUAAGGCCCAUUGCACUCCGGGCCUGAAG CAACGCU

Puzzle: L-glutamine riboswitch. Predict both Free and Bound forms.

Crystal structure kindly provided by: Dinshaw Patel

Reference: Aiming Ren, Yi Xue, Alla Peselis, Alexander Serganov, Hashim M. Al-Hashimi, Dinshaw J. Patel. Structural and Dynamic Basis for Low-Affinity, High- Selectivity Binding of L-Glutamine by the Glutamine Riboswitch. Cell Rep. 2015 Dec 1;13(9):1800-13.01251-6)

PDB id: 5ddo

Bound Form: raw prediction | Assessment results

Free Form: raw prediction | Assessment results

Comments