Sequence (5' to 3'): CCGCCGCGCCAUGCCUGUGGCGG

Puzzle: knowing that the crystal structure shows a homodimer that contains two strands of the sequence. The strands hybridize with blunt ends (C-G closing base pairs).

Crystal structure kindly provided by: Thomas Hermann

Reference: Dibrov SM, McLean J, Hermann T. 2011. Structure of an RNA dimer of a regulatory element from human thymidylate synthase mRNA, Acta Cryst. D, Biological Crystallography 67, 97-104.

PDB id: 3mei

raw prediction | Assessment results

Comments